Research ArticleOriginal Article
Open Access

Testis-specific protein Y-encoded 1 regulates androgen receptor expression through the MAPK/ERK pathway in male hepatocellular carcinoma

Zhaolu Lu, Dongmei Yang, Shanzi Qin, Cuiju Mo, Linyan Zhang, Yingying Ou and Shan Li
Saudi Medical Journal October 2022, 43 (10) 1087-1095; DOI: https://doi.org/10.15537/smj.2022.43.10.20220455

Article Figures & Data

Figures

  • Figure 1
    Figure 1

    - Expression levels of testis-specific Y-encoded protein 1 (TSPY1) and androgen receptor (AR) messenger ribonucleic acid (mRNA) and protein in hepatocellular carcinoma (HCC) cells. A) mRNA expressions levels of the TSPY1 and AR in HCC cells and the mRNA levels correlation analysis scatterplot between TSPY1 and AR (p<0.05); B) the Western blot bands for TSPY1 protein and AR protein in HCC cells; the histogram of gray value of Western blot bands for each protein and the protein levels correlation analysis scatterplot between TSPY1 and AR (p<0.05).

  • Figure 2
    Figure 2

    - The co-localization and interaction of testis-specific Y-encoded protein 1 (TSPY1) and androgen receptor (AR). A) Co-localization of TSPY1 and AR immunofluorescence in MHCC-97H hepatocellular carcinoma (HCC) cells (400x); B) co-localization of TSPY1 and AR immunofluorescence in HCCLM3 HCC cells (400x); C) co-localization of TSPY1 and AR immunofluorescence in male HCC tissues (400x); D) Western blot detection of TSPY1 protein and AR protein in anti-AR co-immunoprecipitation (Co-IP) in MHCC-97H liver cancer cells; E) Western blot detection of TSPY1 protein and AR protein in anti-AR Co-IP in HCCLM3 liver cancer cells (input is the same amount of total protein; control was the negative control; anti-AR Co-IP was the protein sample obtained by immunoprecipitation with rabbit anti-human AR antibody).

  • Figure 3
    Figure 3

    - The role of overexpression and silencing of testis-specific Y-encoded protein 1 (TSPY1) on androgen receptor (AR) regulation in HCC cells. A) The fluorescence figure of Huh7 cells over-expressing TSPY1 (100X); B) the flow cytometry was used to detect transfection efficiency in the TSPY1 over-expressing Huh7 cells; C) effects of over expression of TSPY1 on AR in Huh7 cells: the expression levels of TSPY1 and AR genes (*compared with the control group [GFP], p<0.05); D) AR and TSPY1 protein expression levels in Huh7 cells over-expressing TSPY1 and histogram of gray value of Western blot bands (*compared with the GFP group, p<0.05); E) fluorescence figure of HCCLM3 cells knockdown TSPY1 (100X); F) the flow cytometry was used to detect transfection efficiency in the TSPY1 knockdown HCCLM3 cells; G) effects of silencing TSPY1 on the regulation of AR in HCCLM3: messenger ribonucleic acid expression levels of TSPY1 and AR in HCCLM3 cells in silencing TSPY1 (*compared with the control group [mock], p<0.05); H) AR and TSPY1 protein expression levels in HCCLM3 cells silencing TSPY1 and histogram of gray value of Western blot bands (*compared with the mock group, p<0.05).

  • Figure 4
    Figure 4

    - The mechanism by which testis-specific Y-encoded protein 1 (TSPY1) regulates androgen receptor (AR) expression in male HCC. A) Key molecules expression levels of mitogen activated protein kinase (MAPK) signaling pathways and their phosphorylation levels in Huh7 cells over-expressing TSPY1 and the histogram of gray value of Western blot bands (*compared with the control group [GFP], p<0.05); B) key molecules expression levels of MAPK signaling pathways and their phosphorylation levels in HCCLM3 cells silencing TSPY1 and the histogram of gray value of Western blot bands (*compared with the control group [mock group], p<0.05); C) expression levels of AR and P-ERK1/2 in Huh7 cells after inhibition of MAPK/ERK signaling pathway and the histogram of gray value of Western blot bands for each protein (*compared with the TSPY1 group, p<0.05).

Tables

  • Table 1

    - List of primers used for quantitative reverse transcription-polymerase chain reaction.

    GenesPrimer sequences
    TSPY1Forward: 5’- ATGTTGTTCTTTCGGAGTAACCC -3’
    Reverse: 5’- TGAGAAGCCCTGTATTCTGTGAT -3’
    ARForward: 5’- ACTCCAGGATGCTCTACTTCG -3’
    Reverse: 5’- AGGTGCCTCATTCGGACA -3’
    β-actinForward: 5’- CATGTACGTTGCTATCCAGGC -3’
    Reverse: 5’- CTCCTTAATGTCACGCACGAT -3’

    TSPY1: testis-specific Y-encoded protein 1, AR: androgen receptor, β-actin: Beta-actin

    • Table 2

      - The clinical and pathological features of hepatocellular carcinoma tissues.

      FeaturesHepatocellular carcinoma
      GenderMale
      Age (years)3940607753
      BCLCBBCAA
      T stage23211
      N stage01100
      M stage00000
      Tumor size≤5 cm≤5 cm≤5 cm≤5 cm≤5 cm
      HBV DNA (IU/ml)1.93×1063.25×103<5.00×102<5.00×102<5.00×102
      Hepatitis B surface AgPositivePositivePositivePositivePositive
      Serum AFP (ng/ml)3198.756316.9960.2233.041434.1
      PIVKA (ug/L)1520.77010.49687.56222.55552.24

      BCLC: Barcelona clinic liver cancer, T stage: the size and extent of the main tumor, N stage: the number of nearby lymph nodes that have cancer, M stage: whether the cancer has metastasized, HBV: hepatitis B virus, AFP: alpha-fetoprotein, PIVKA: protein induced by vitamin K absence

      Back to top

      In this issue

      Print
      Download PDF
      Email Article
      Citation Tools
      Bookmark this article

      Jump to section

      Keywords