Skip to main content

Main menu

  • Home
  • Content
    • Latest
    • Archive
    • home
  • Info for
    • Authors
    • Reviewers
    • Subscribers
    • Institutions
    • Advertisers
    • Join SMJ
  • About Us
    • About Us
    • Editorial Office
    • Editorial Board
  • More
    • Advertising
    • Alerts
    • Feedback
    • Folders
    • Help
  • Other Publications
    • NeuroSciences Journal

User menu

  • My alerts
  • Log in

Search

  • Advanced search
Saudi Medical Journal
  • Other Publications
    • NeuroSciences Journal
  • My alerts
  • Log in
Saudi Medical Journal

Advanced Search

  • Home
  • Content
    • Latest
    • Archive
    • home
  • Info for
    • Authors
    • Reviewers
    • Subscribers
    • Institutions
    • Advertisers
    • Join SMJ
  • About Us
    • About Us
    • Editorial Office
    • Editorial Board
  • More
    • Advertising
    • Alerts
    • Feedback
    • Folders
    • Help
  • Follow psmmc on Twitter
  • Visit psmmc on Facebook
  • RSS
Research ArticleOriginal Article
Open Access

Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

Muhammad I. Ullah, Arsalan Ahmad, Milena Žarković, Syed S. Shah, Abdul Nasir, Saqib Mahmood, Wasim Ahmad, Christian A. Hübner and Muhammad J. Hassan
Saudi Medical Journal December 2017, 38 (12) 1190-1195; DOI: https://doi.org/10.15537/smj.2017.12.20989
Muhammad I. Ullah
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
M.Phil, PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Arsalan Ahmad
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
MBBS, MD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Milena Žarković
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
MS
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Syed S. Shah
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
MBBS, Ph.D
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Abdul Nasir
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
MSc, MPhil
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Saqib Mahmood
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
MBBS, PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Wasim Ahmad
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
M.Phil, PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Christian A. Hübner
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
MD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Muhammad J. Hassan
From the Department of Biochemistry (Ullah, Ahmad W), Faculty of Biological Sciences, Quaid-i-Azam University, the Division of Neurology (Ahmad A), Shifa International Hospital, Section of Forensic Medicine (Shah), Shifa College of Medicine, Shifa Tameer-e-Millat University, the Department of Healthcare Biotechnology (Hassan), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences & Technology, Islamabad, the Department of Biochemistry (Ullah), University of Health Sciences, the Department of Human Genetics and Molecular Biology (Mahmood), University of Health Sciences, Lahore, the Department of Biochemistry (Nasir), Abdul Wali Khan University Mardan, Mardan, Pakistan, and the Institute of Human Genetics (Žarković), University of Jena, Jena, Germany
M.Phil, PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: [email protected]
  • Article
  • Figures & Data
  • eLetters
  • Info & Metrics
  • References
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Figure 1
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1

    Mutation analysis and homology modeling of DYSF. A) Pedigree of multi-generation Pakistani family showing co-segregation of a novel duplication (c.897_918dupCTTCAACTTGTTTGACTCTCCT) with the disease and B) sequence electropherograms for a wild-type (V:2), heterozygous (IV:2) and homozygous individual (V:3) with 22 nucleotide duplication in DYSF. Comparative homology modeling proposed distinct alterations in dysferlin protein while comparing the C) wild-type with D) mutant type.

  • Figure 2
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2

    Images of affected individual (V:3) of Miyoshi myopathy family showing atrophy of A) proximal muscles, B) forearm muscles, and C) intrinsic muscles of the hand.

Tables

  • Figures
  • Table 1
  • Table 2
PreviousNext
Back to top

In this issue

Saudi Medical Journal: 38 (12)
Saudi Medical Journal
Vol. 38, Issue 12
1 Dec 2017
  • Table of Contents
  • Cover (PDF)
  • Index by author
Print
Download PDF
Email Article

Thank you for your interest in spreading the word on Saudi Medical Journal.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
(Your Name) has sent you a message from Saudi Medical Journal
(Your Name) thought you would like to see the Saudi Medical Journal web site.
Citation Tools
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Muhammad I. Ullah, Arsalan Ahmad, Milena Žarković, Syed S. Shah, Abdul Nasir, Saqib Mahmood, Wasim Ahmad, Christian A. Hübner, Muhammad J. Hassan
Saudi Medical Journal Dec 2017, 38 (12) 1190-1195; DOI: 10.15537/smj.2017.12.20989

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy
Muhammad I. Ullah, Arsalan Ahmad, Milena Žarković, Syed S. Shah, Abdul Nasir, Saqib Mahmood, Wasim Ahmad, Christian A. Hübner, Muhammad J. Hassan
Saudi Medical Journal Dec 2017, 38 (12) 1190-1195; DOI: 10.15537/smj.2017.12.20989
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One
Bookmark this article

Jump to section

  • Article
    • Abstract
    • Methods
    • Results
    • Discussion
    • Acknowledgment
    • Footnotes
    • References
  • Figures & Data
  • eLetters
  • References
  • Info & Metrics
  • PDF

Related Articles

  • No related articles found.
  • PubMed
  • Google Scholar

Cited By...

  • A new dysferlin gene mutation in a Portuguese family with Miyoshi myopathy
  • Google Scholar

More in this TOC Section

  • The risk factors for cardiovascular disease and chronic kidney disease in patients with nonalcoholic fatty liver disease in Saudi Arabia
  • Prolonged flight exposure and its effects on sinonasal health among aircrew members
  • Identifying individuals at risk of post-stroke depression
Show more Original Article

Similar Articles

CONTENT

  • home

JOURNAL

  • home

AUTHORS

  • home
Saudi Medical Journal

© 2025 Saudi Medical Journal Saudi Medical Journal is copyright under the Berne Convention and the International Copyright Convention.  Saudi Medical Journal is an Open Access journal and articles published are distributed under the terms of the Creative Commons Attribution-NonCommercial License (CC BY-NC). Readers may copy, distribute, and display the work for non-commercial purposes with the proper citation of the original work. Electronic ISSN 1658-3175. Print ISSN 0379-5284.

Powered by HighWire