Article Figures & Data
Figures
- Figure 1
Mutation analysis and homology modeling of DYSF. A) Pedigree of multi-generation Pakistani family showing co-segregation of a novel duplication (c.897_918dupCTTCAACTTGTTTGACTCTCCT) with the disease and B) sequence electropherograms for a wild-type (V:2), heterozygous (IV:2) and homozygous individual (V:3) with 22 nucleotide duplication in DYSF. Comparative homology modeling proposed distinct alterations in dysferlin protein while comparing the C) wild-type with D) mutant type.
- Figure 2
Images of affected individual (V:3) of Miyoshi myopathy family showing atrophy of A) proximal muscles, B) forearm muscles, and C) intrinsic muscles of the hand.
