Skip to main content

Main menu

  • Home
  • Content
    • Latest
    • Archive
    • home
  • Info for
    • Authors
    • Reviewers
    • Subscribers
    • Institutions
    • Advertisers
    • Join SMJ
  • About Us
    • About Us
    • Editorial Office
    • Editorial Board
  • More
    • Advertising
    • Alerts
    • Feedback
    • Folders
    • Help
  • Other Publications
    • NeuroSciences Journal

User menu

  • My alerts
  • Log in

Search

  • Advanced search
Saudi Medical Journal
  • Other Publications
    • NeuroSciences Journal
  • My alerts
  • Log in
Saudi Medical Journal

Advanced Search

  • Home
  • Content
    • Latest
    • Archive
    • home
  • Info for
    • Authors
    • Reviewers
    • Subscribers
    • Institutions
    • Advertisers
    • Join SMJ
  • About Us
    • About Us
    • Editorial Office
    • Editorial Board
  • More
    • Advertising
    • Alerts
    • Feedback
    • Folders
    • Help
  • Follow psmmc on Twitter
  • Visit psmmc on Facebook
  • RSS
Research ArticleOriginal Article
Open Access

Molecular characterization of Helicobacter pylori clinical isolates from Eastern Saudi Arabia

Khaled R. Alkharsah, Reem Y. Aljindan, Aisha M. Alamri, Amer I. Alomar and Abdulaziz A. Al-Quorain
Saudi Medical Journal October 2022, 43 (10) 1128-1135; DOI: https://doi.org/10.15537/smj.2022.43.10.20220355
Khaled R. Alkharsah
From the Department of Microbiology (Alkharsah, Aljindan), College of Medicine; from the Department of Clinical Laboratory Sciences (Alamri, Alomar), College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, Dammam, and from the Department of Gastroenterology (Al-Quorain), King Fahd Hospital of the University, Alkhobar, Kingdom of Saudi Arabia.
PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: [email protected]
Reem Y. Aljindan
From the Department of Microbiology (Alkharsah, Aljindan), College of Medicine; from the Department of Clinical Laboratory Sciences (Alamri, Alomar), College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, Dammam, and from the Department of Gastroenterology (Al-Quorain), King Fahd Hospital of the University, Alkhobar, Kingdom of Saudi Arabia.
PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Aisha M. Alamri
From the Department of Microbiology (Alkharsah, Aljindan), College of Medicine; from the Department of Clinical Laboratory Sciences (Alamri, Alomar), College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, Dammam, and from the Department of Gastroenterology (Al-Quorain), King Fahd Hospital of the University, Alkhobar, Kingdom of Saudi Arabia.
PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Amer I. Alomar
From the Department of Microbiology (Alkharsah, Aljindan), College of Medicine; from the Department of Clinical Laboratory Sciences (Alamri, Alomar), College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, Dammam, and from the Department of Gastroenterology (Al-Quorain), King Fahd Hospital of the University, Alkhobar, Kingdom of Saudi Arabia.
PhD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Abdulaziz A. Al-Quorain
From the Department of Microbiology (Alkharsah, Aljindan), College of Medicine; from the Department of Clinical Laboratory Sciences (Alamri, Alomar), College of Applied Medical Sciences, Imam Abdulrahman Bin Faisal University, Dammam, and from the Department of Gastroenterology (Al-Quorain), King Fahd Hospital of the University, Alkhobar, Kingdom of Saudi Arabia.
MD
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • eLetters
  • Info & Metrics
  • References
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Figure 1
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 1

    - Percentage of positive virulence genes and genotype combinations in Helicobacter pylori isolates. The VacA S1 and S2 values are calculated from the VacA S total positive.31 The VacA M1 and M2 values are calculated from the VacA M total positive.33 The VacA S value is calculated from the total isolates.34 The VacA M value is calculated from the total isolates.34 The genotypes combinations values are calculated out of 30 isolates. VacA: vacuolating cytotoxin A

  • Figure 2
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 2

    - Sequence alignment of the 23s rRNA gene fragment.

  • Figure 3
    • Download figure
    • Open in new tab
    • Download powerpoint
    Figure 3

    - Phylogenetic tree of the Helicobacter pylori isolates from Saudi Arabia and other regional and global isolates based on the 23s rRNA gene fragment. The circles indicate the isolates with the mentioned mutations.

Tables

  • Figures
    • View popup
    Table 1

    - Primer sequences and amplicon size.

    PrimersSequencesBand sizes (bp)References
    VacA (s)-F5’ATGGAAATACAACAAACACAC3’s1: 259, s2: 28618,19
    VacA (s)-R5’CTGCTTGAATGCGCCAAAC3’
    VacA (m)-F5’CAATCTGTCCAATCAAGCGAG3’m1: 570, m2: 642
    VacA (m)-R5’GCGTCTAAATAATTCCAAGG3’
    CagA-F5’AATACACCAACGCCTCCA3’400
    CagA-R5’TTGTTGCCGCTTTTGCTCTC3’
    23s-FATGAATGGCGTAACGAGATG36120
    23s-RGGAAATCGCAAGTTGAGTGT

    VacA: vacuolating cytotoxin A, CagA: cytotoxin associated antigen A

      • View popup
      Table 2

      - Demographic and clinical data of the patients infected with Helicobacter pylori.

      VariablesMale (n=17)Female (n=17)
      Age (years)
      19-30
      31-40
      41-50
      51-60
      >60
      7 (53.8)
      4 (50.0)
      2 (40.0)
      3 (42.9)
      1 (100)
      6 (46.1)
      4 (50.0)
      3 (60.0)
      4 (57.1)
      0 (0.0)
      Nationality
      Saudi
      Non-Saudi
      14 (50.0)
      3 (50.0)
      14 (50.0)
      3 (50.0)
      Endoscopic findings (gastritis)
      Mild
      Moderate
      Severe
      Nodular
      Erosive
      5 (41.7)
      4 (66.7)
      2 (100)
      2 (66.7)
      3 (75.0)
      7 (58.3)
      2 (33.3)
      0 (0.0)
      1 (33.3)
      1 (25.0)
      Prior eradication therapy
      Unknown
      Once
      Twice
      4 (50.0)
      13 (52.0)
      0 (0.0)
      4 (50.0)
      12 (48.0)
      1 (100)

      Values are presented as number and precentage (%).

      PreviousNext
      Back to top

      In this issue

      Saudi Medical Journal: 43 (10)
      Saudi Medical Journal
      Vol. 43, Issue 10
      1 Oct 2022
      • Table of Contents
      • Cover (PDF)
      • Index by author
      Print
      Download PDF
      Email Article

      Thank you for your interest in spreading the word on Saudi Medical Journal.

      NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

      Enter multiple addresses on separate lines or separate them with commas.
      Molecular characterization of Helicobacter pylori clinical isolates from Eastern Saudi Arabia
      (Your Name) has sent you a message from Saudi Medical Journal
      (Your Name) thought you would like to see the Saudi Medical Journal web site.
      Citation Tools
      Molecular characterization of Helicobacter pylori clinical isolates from Eastern Saudi Arabia
      Khaled R. Alkharsah, Reem Y. Aljindan, Aisha M. Alamri, Amer I. Alomar, Abdulaziz A. Al-Quorain
      Saudi Medical Journal Oct 2022, 43 (10) 1128-1135; DOI: 10.15537/smj.2022.43.10.20220355

      Citation Manager Formats

      • BibTeX
      • Bookends
      • EasyBib
      • EndNote (tagged)
      • EndNote 8 (xml)
      • Medlars
      • Mendeley
      • Papers
      • RefWorks Tagged
      • Ref Manager
      • RIS
      • Zotero
      Share
      Molecular characterization of Helicobacter pylori clinical isolates from Eastern Saudi Arabia
      Khaled R. Alkharsah, Reem Y. Aljindan, Aisha M. Alamri, Amer I. Alomar, Abdulaziz A. Al-Quorain
      Saudi Medical Journal Oct 2022, 43 (10) 1128-1135; DOI: 10.15537/smj.2022.43.10.20220355
      Twitter logo Facebook logo Mendeley logo
      • Tweet Widget
      • Facebook Like
      • Google Plus One
      Bookmark this article

      Jump to section

      • Article
        • Abstract
        • Methods
        • Results
        • Discussion
        • Acknowledgment
        • Footnotes
        • References
      • Figures & Data
      • eLetters
      • References
      • Info & Metrics
      • PDF

      Related Articles

      • No related articles found.
      • PubMed
      • Google Scholar

      Cited By...

      • No citing articles found.
      • Google Scholar

      More in this TOC Section

      • The risk factors for cardiovascular disease and chronic kidney disease in patients with nonalcoholic fatty liver disease in Saudi Arabia
      • Prolonged flight exposure and its effects on sinonasal health among aircrew members
      • Identifying individuals at risk of post-stroke depression
      Show more Original Article

      Similar Articles

      Keywords

      • H. Pylori
      • clarithromycin
      • resistance
      • Saudi Arabia
      • 23s rRNA

      CONTENT

      • home

      JOURNAL

      • home

      AUTHORS

      • home
      Saudi Medical Journal

      © 2025 Saudi Medical Journal Saudi Medical Journal is copyright under the Berne Convention and the International Copyright Convention.  Saudi Medical Journal is an Open Access journal and articles published are distributed under the terms of the Creative Commons Attribution-NonCommercial License (CC BY-NC). Readers may copy, distribute, and display the work for non-commercial purposes with the proper citation of the original work. Electronic ISSN 1658-3175. Print ISSN 0379-5284.

      Powered by HighWire